Profile cover photo
Profile photo
Jake Heare
79 followers -
Wasteland Wanderer
Wasteland Wanderer

79 followers
About
Jake's posts

Post has attachment
October 2015 Goals
It's the beginning of the month, so its time for GOOOOAAAAALLLLLLSSSSSSSS!!!!! But first lets check in on last months goals. September 2015 Goals 1.Complete Results, Chapter 2, Thesis 2. Sending Draft of thesis to committee (mid Sept) 3. Begin preparations ...

Post has attachment
9 1 2015 Mean Ct Value Stats and Graphs R script
Steven has been helping me cull and curate the Ct values from the qPCR runs over the summer. He's developed a spreadsheet of mean Ct values of the good replicate runs. I've taken those values and created delta Ct values of the target over Actin. Then I log ...

Post has attachment
September 2015 Goals
Its September 1st, Time for GOALLLLLLLLSSSSSSSSS!!!!! Let's take a quick look at the goals for last month and what I accomplished of them. August 2015 Goals 1.Complete Analysis of qPCR data 2. Write Results 3. Complete Chapter 2 4. Complete Thesis 5. Schedu...

Post has attachment
8 26 2015 28s CTM qPCR 2
Today I ran two reps of the 28s target, one on the opticon and one at the CFX. We may use this as a normalizing gene if the reads look consistent. This is the run on the CFX.  Primers: 1702 28s_3_FWD TAAGGCCAGTGTGGGAGAGA JH 8/12/2015 20 55 59.88 O.lurida "2...

Post has attachment
8 26 2015 28s CTM qPCR 1
Today I ran two reps of the 28s target, one on the opticon and one at the CFX. We may use this as a normalizing gene if the reads look consistent. This is the run on the opticon.  Primers: 1702 28s_3_FWD TAAGGCCAGTGTGGGAGAGA JH 8/12/2015 20 55 59.88 O.lurid...

Post has attachment
8 18 2015 CARM CTM2 reps qPCR
Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran CARM. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials mad...

Post has attachment
8 15 2015 CRAF CTM2 reps qPCR
Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran CRAF To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials made...

Post has attachment
8 15 2015 PGRP CTM2 reps qPCR
Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran PGRP. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials mad...

Post has attachment
8 15 2015 H2AV CTM2 reps qPCR
Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran H2AV. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials mad...

Post has attachment
8 15 2015 CARM CTM2 reps qPCR
Today I ran replicates of all populations and all treatments to generate data about expression values. Here I ran CARM. To save on cDNA I stopped running full replicates of the Control and Temperature samples with the mech stress samples. I run partials mad...
Wait while more posts are being loaded