Profile

Cover photo
Eric Moyer
Worked at Wright State University
117 followers|101,897 views
AboutPostsPhotosVideosReviews

Stream

Eric Moyer

Shared publicly  - 
 
Rats who take marijuana during adolescence change not only their own gene expression for the rest of their lives but that of their children, grandchildren and great-grandchildren. Even if those are raised by parents who were never exposed to drugs. And this has behavioral consequences in making them more susceptible to addiction.

(I took an hour off work to hear Yasmin Hurd's lecture "High times for drugs: Epigenetic imprint, legacy and brain" http://neuroscience.mssm.edu/hurd/ - you'll be able to find the lecture on YouTube in a couple of days)
1
2
Add a comment...

Eric Moyer

Shared publicly  - 
 
The newspapers here have been buzzing about #Powerball. So I did a quick calculation:

Given that the odds for a ticket are 1 in 292,000,000, I'd have to play a number every second for 42+ years without sleeping to have a 99% chance of winning. I could cut that down to 6 years if I were satisfied with a coin-flip. Even though the average ticket makes a profit, I won't bite.

http://www.wolframalpha.com/input/?i=1344709692+seconds
http://www.wolframalpha.com/input/?i=1-%281-1%2F292000000%29%5Ex+%3D+99%2F100
3
1
Brad Shivers's profile photoEric Moyer's profile photo
3 comments
 
Months of without-replacement ticket-buying:years to 99%=
1:42.42
2:42.22
3:42.04
4:41.84
5:41.65
6:41.45
12(1y):40.27
24(2y):37.82
48(4y):32.54
96(8y):18.43
buying 99% of tickets: 109.92 mo = 9.16 yr, 99% chance by definition.
You can see that the decrease in time to reach 99% is heavily loaded at the end (the last year of without-replacement ticket-buying gets you 9+ yrs of decrease whereas the first year got 2 yrs of savings)
Add a comment...

Eric Moyer

Shared publicly  - 
 
From my co-worker today:
The first 90% of the project is not nearly as scary as the second 90%.

( See also https://en.wikipedia.org/wiki/Ninety-ninety_rule )
2
Add a comment...

Eric Moyer

Shared publicly  - 
 
Alzheimer's disease may be your brain getting moldy
1
Chris Stehlik's profile photo
 
Wow , you think that that would have been noticed before now.
Add a comment...

Eric Moyer

Shared publicly  - 
 
This is making the rounds at work. It's not as easy as it looks.

https://docs.google.com/forms/d/1kckcq_uv8dk9-W5rIdtqRwCHN4Uh209ELPUjTEZJDxc/viewform
Drive
Is it Pokémon or #bigdata technology?You is able to tell which nonsense word is Pokémon character and which is the latest craze in #bigdata technology? You just might qualify as #bigdata expert. Much success!
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
FTL Travel in a browser! (if it doesn't seem faster than light, change KM to light-minutes and watch em fly by)
It would take about seven months to travel this distance in a spaceship. Better be some good in-flight entertainment. In case you're wondering, you'd need about 2000 feature-length movies to occupy that many waking hours. Sit back and relax. Jupiter is more than 3 times as far as we just ...
1
Peggy Moyer's profile photo
 
How to feel your exact insignificance and amazing existance at the same time. Thanks Eric and Josh!
Add a comment...

Eric Moyer

Shared publicly  - 
 
I didn't know genomes came this small (and this is probably not the smallest - I just ran into it).

>gi|162944684|ref|NC_010165.1| Citrus viroid V, complete genome
TGGGTGAACAACCTTGTGGTTCCTGTGGGTCACCCCGCCCCACGGAATAATAAAAGCAGAGGAGTAGAGA
GTACTCACCTGTCGTCGTCGACGAAGGCCGGTGAGCAGTAAGCCGGACGGTCCCCTCGCGGCCGATCCTC
TGGAGCTCTGCTCTAAGATCTTCGCTGCTGAGGCCCGCGCCGCCGCTCTTCCGCGCTGCTAGTCGAGCGG
ACGTTGGTGGTCTCCCTCTCCCTGTGCAATAAAATCCAGGTGGCGAGTGGTGTCCCCAGGGTAAAACACG
ATTGGTGTTCTCCC

Source: http://www.ncbi.nlm.nih.gov/nuccore/162944684?report=fasta
1
1
Chris Stehlik's profile photo
 
That's pretty small. It just hijacks cells though 
Add a comment...
In his circles
133 people
Have him in circles
117 people
Michael Raymer's profile photo
Sandun Rajitha's profile photo
Gary Burns's profile photo
harshal patni's profile photo
Brooke Allen's profile photo
David Moyer's profile photo
Matthew D Fritz's profile photo
Peggy Moyer's profile photo
Dispenser Liang's profile photo

Eric Moyer

Shared publicly  - 
 
"Science is an ongoing race between our inventing ways to fool ourselves, and our inventing ways to avoid fooling ourselves."

--http://www.nature.com/news/how-scientists-fool-themselves-and-how-they-can-stop-1.18517
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
Sample lyrics "And we chordates have tails and gill slits and notochords" (where Handel wrote "And he shall reign forever and eh-eh-ver")

Don't miss it.
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
Cleaning out my inbox (I'm almost back to June), the following article seems prescient given yesterday's headlines:

https://www.linkedin.com/pulse/forget-greece-real-financial-crisis-happening-china-steve-blakeman
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
Hallucinating, arty ANN's - cool. And it reminds me of a paper I read in the 90's where a man took a back-propagation network trained to recognize classes of things, clamped the outputs at 100% recognition and ran the network backwards. He perturbed the weights just a little bit and this gave him many examples of patterns that fell into the class he had trained on. (The example I remember best was positions of human joints in natural poses.)
2
Add a comment...

Eric Moyer

Shared publicly  - 
 
A great new paradigm for looking at databases: turning the log into a first-class citizen with a hackable API.
This is an edited and expanded transcript of a talk I gave at Strange Loop 2014. The video recording (embedded below) has been watched over 8,000 times. For those of you who prefer reading, I thoug...
1
Dan Wlodarski's profile photo
 
Hmm... Must read up on this!
Add a comment...
People
In his circles
133 people
Have him in circles
117 people
Michael Raymer's profile photo
Sandun Rajitha's profile photo
Gary Burns's profile photo
harshal patni's profile photo
Brooke Allen's profile photo
David Moyer's profile photo
Matthew D Fritz's profile photo
Peggy Moyer's profile photo
Dispenser Liang's profile photo
Links
YouTube
Work
Occupation
Researcher
Employment
  • Wright State University
    Research Assistant, 2007 - 2014
Basic Information
Gender
Male
The Mediterranean Panini was delicious. I wish I were staying another day so I could eat it again. The restaurant is simple and clean, the staff pleasant. The phone rang frequently, so it appears most of their business is delivery.
Public - 2 years ago
reviewed 2 years ago
I noticed that the Google Maps satellite view just displayed an empty field. I assumed that this must be a new business. I tried calling the phone number and the phone was answered but no one was on the other end. I assumed that the new business had a malfunctioning answering system, so I decided to go there. On 26 Feb 2013, I traveled to the address and discovered an empty field. There is no GreenOhio computer recycling. No one else should waste their time going there.
Public - 3 years ago
reviewed 3 years ago
3 reviews
Map
Map
Map
I have had several repairs done by Bob. He has always charged a reasonable price and the repairs have stuck. I even had one time when I came in for a diagnosis and he fixed the problem for free. My landlord has also done business with him and recommends him highly.
Public - 8 years ago
reviewed 8 years ago