Profile

Cover photo
Eric Moyer
Worked at Wright State University
115 followers|74,510 views
AboutPostsPhotosVideosReviews

Stream

Eric Moyer

Shared publicly  - 
 
FTL Travel in a browser! (if it doesn't seem faster than light, change KM to light-minutes and watch em fly by)
It would take about seven months to travel this distance in a spaceship. Better be some good in-flight entertainment. In case you're wondering, you'd need about 2000 feature-length movies to occupy that many waking hours. Sit back and relax. Jupiter is more than 3 times as far as we just ...
1
Peggy Moyer's profile photo
 
How to feel your exact insignificance and amazing existance at the same time. Thanks Eric and Josh!
Add a comment...

Eric Moyer

Shared publicly  - 
 
I didn't know genomes came this small (and this is probably not the smallest - I just ran into it).

>gi|162944684|ref|NC_010165.1| Citrus viroid V, complete genome
TGGGTGAACAACCTTGTGGTTCCTGTGGGTCACCCCGCCCCACGGAATAATAAAAGCAGAGGAGTAGAGA
GTACTCACCTGTCGTCGTCGACGAAGGCCGGTGAGCAGTAAGCCGGACGGTCCCCTCGCGGCCGATCCTC
TGGAGCTCTGCTCTAAGATCTTCGCTGCTGAGGCCCGCGCCGCCGCTCTTCCGCGCTGCTAGTCGAGCGG
ACGTTGGTGGTCTCCCTCTCCCTGTGCAATAAAATCCAGGTGGCGAGTGGTGTCCCCAGGGTAAAACACG
ATTGGTGTTCTCCC

Source: http://www.ncbi.nlm.nih.gov/nuccore/162944684?report=fasta
1
1
Chris Stehlik's profile photo
 
That's pretty small. It just hijacks cells though 
Add a comment...

Eric Moyer

Shared publicly  - 
 
Shifted 1's Problem
This will be a blog post on the shifted 1's problem. I reference it in my thesis but haven't finished writing it yet. I am publishing it now because I need a URL to reference.
This will be a blog post on the shifted 1's problem. I reference it in my thesis but haven't finished writing it yet. I am publishing it now because I need a URL to reference.
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
My dinner reading today included some very disturbing findings. Very worth reading for anyone who cares about freedom or justice or civilization.
Vox.com
There’s a simple theory underlying much of American politics. It sits hopefully at the base of almost every speech, every op-ed, every article, and every panel discussion. It courses through the...
1
Amit Sheth's profile photoEric Moyer's profile photoChris Stehlik's profile photo
3 comments
 
A non zero number of people change their party affiliation each election.  This takes an affirmative action. This suggest people can change.
However, when the article talks about not enough or to much information, it is getting it wrong. It's not necessarily concrete facts that are missing, but that different people may have different values, and also that people can take irrational positions that are in fact detrimental to their economic well being due to emotional stances. Like poorer people who support unfettered capitalism despite that making their situation worse because they feel very strongly that they shouldn't need any outside help.

This is a related article to that point that I read today. http://www.salon.com/2013/11/17/americas_angriest_white_men_up_close_with_racism_rage_and_southern_supremacy/
Simple economic facts won't change their opinion, but discussions on values and what make people feel valued  and how their can contribute might.
Add a comment...

Eric Moyer

Shared publicly  - 
 
Testing hangouts #hangoutpost
Eric Moyer was in a video call
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
There is no intuitive interface, not even the nipple. It's all learned. -- Bruce Ediger

(If you don't believe this, ask a lactation consultant.)

see http://www.greenend.org.uk/rjk/misc/nipple.html for variants of this quote
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
Near linear (in number of nodes) solution to the max-flow problem.
Since max-flow is an important component of many AI and machine learning techniques, this discovery could have wonderful implications.
1
Add a comment...
Have him in circles
115 people
King Soft's profile photo
Michael Raymer's profile photo
maryam panahiazar's profile photo
Knoesis Center's profile photo
Tom Wolf's profile photo
Ashutosh Jadhav's profile photo
Matthew Roberts's profile photo
Elaine Holmberg's profile photo
Carolina Moyer's profile photo

Eric Moyer

Shared publicly  - 
 
A great new paradigm for looking at databases: turning the log into a first-class citizen with a hackable API.
This is an edited and expanded transcript of a talk I gave at Strange Loop 2014. The video recording (embedded below) has been watched over 8,000 times. For those of you who prefer reading, I thoug...
1
Dan Wlodarski's profile photo
 
Hmm... Must read up on this!
Add a comment...

Eric Moyer

Shared publicly  - 
 
I was brushing up on my SQL in preparation for job interviews and I came across the Mandelbrot set calculated in pure SQL. Wow!
WITH RECURSIVE x(i) AS ( VALUES(0) UNION ALL SELECT i + 1 FROM x WHERE i < 101 ), Z(Ix, Iy, Cx, Cy, X, Y, I) AS ( SELECT Ix, Iy, X::float, Y::float, X::float, Y::float, 0 FROM (SELECT -2.2 + 0.031 * i, i FROM x) AS xgen(x,ix) CROSS JOIN (SELECT -1.5 + 0.031 * i, i FROM x) AS ygen(y,iy) UNION ALL ...
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
Diversity fail: "We accept people from all backgrounds - except Mac users."
( Source: http://www.nationwidechildrens.org/healthcare-career-opportunities - a popup doesn't let you continue if you are not using IE )
1
Peggy Moyer's profile photo
 
Where  do you find this stuff?:*)
Add a comment...

Eric Moyer

Shared publicly  - 
 
While the majority of Heartbleed holes will be plugged quickly, many devices aren't capable of being fixed.
1
Add a comment...

Eric Moyer

Shared publicly  - 
 
Linked in is now doing censorship on behalf of the Chinese government. On one hand, it is the price of doing business in China. On the other hand, it is sad.
1
Dan Wlodarski's profile photo
 
It may take a few generations, but the path of history does arc towards justice.
Add a comment...
People
Have him in circles
115 people
King Soft's profile photo
Michael Raymer's profile photo
maryam panahiazar's profile photo
Knoesis Center's profile photo
Tom Wolf's profile photo
Ashutosh Jadhav's profile photo
Matthew Roberts's profile photo
Elaine Holmberg's profile photo
Carolina Moyer's profile photo
Basic Information
Gender
Male
Work
Occupation
Researcher
Employment
  • Wright State University
    Research Assistant, 2007 - 2014
Links
YouTube
The Mediterranean Panini was delicious. I wish I were staying another day so I could eat it again. The restaurant is simple and clean, the staff pleasant. The phone rang frequently, so it appears most of their business is delivery.
Public - a year ago
reviewed a year ago
I noticed that the Google Maps satellite view just displayed an empty field. I assumed that this must be a new business. I tried calling the phone number and the phone was answered but no one was on the other end. I assumed that the new business had a malfunctioning answering system, so I decided to go there. On 26 Feb 2013, I traveled to the address and discovered an empty field. There is no GreenOhio computer recycling. No one else should waste their time going there.
Public - 2 years ago
reviewed 2 years ago
3 reviews
Map
Map
Map
I have had several repairs done by Bob. He has always charged a reasonable price and the repairs have stuck. I even had one time when I came in for a diagnosis and he fixed the problem for free. My landlord has also done business with him and recommends him highly.
Public - 7 years ago
reviewed 7 years ago