Profile

Cover photo
Paul Macklin
Works at University of Southern California
Attended University of California, Irvine
Lives in Pasadena, CA USA
174 followers|110,219 views
AboutPostsPhotosYouTube

Stream

Paul Macklin

commented on a post on Blogger.
Shared publicly  - 
 
This is really neat work, and it's very helpful to have the "big picture" of several papers in one place. Do you plan to submit this? 
1
Philip Gerlee's profile photoJacob Scott's profile photoPaul Macklin's profile photo
4 comments
 
Thanks, but I meant for the in press destination ;-)

Add a comment...

Paul Macklin

Shared publicly  - 
 
A few weeks ago, my friend and colleague +Philip Gerlee wrote a post on his blog with about the role of mathematics in oncology in which he generally suggested that our role, to date, as mathematical/theoretical oncologists h...
1
Artem Kaznatcheev's profile photoPaul Macklin's profile photo
2 comments
 
+Artem Kaznatcheev Thanks, and honored to be thought of!

Also, very excited to hear about your continuing work with David! Fantastic! 

I'll try to pop in here today or tomorrow -- you guys have me thinking. :-) 

I have a blog but generally don't write as much lately as I'd like.  Might have to start that up again. ;-) 

BTW, it may interest you that we've lately been thinking about a lot about a particular mouse model of B-cell lymphoma, and modeling (and calibrating!) cell trafficking and immune response.  ;-)
Add a comment...

Paul Macklin

Shared publicly  - 
 
Alas, perhaps a bit limited in applicability outside sequencing ... ?

But any measure of heterogeneity should probably try to include both intrinsic heterogeneity (e.g., sequencing as above -- heterogeneity that would exist even in a purely homogenous environment) and extrinsic heterogeneity (e.g., oxygen, glucose, pH gradients -- heterogeneity that would cause phenotypic heterogeneity even in 100% identical cells).

Then perhaps also functional heterogeneity measurements: cycling fraction, apoptotic fraction, etc. .... 
1
Jacob Scott's profile photo
 
I totally agree +Paul Macklin  - there is more to heterogeneity than the genes.  Could this sort of formalism be added to, using the same methodology though, and just adding a bit string at the end of the genomic data to represent the non-genomic heterogeneity?

GATCGATCAGTACCGTTGTAACCATT 010101  

or something?
Add a comment...

Paul Macklin

Shared publicly  - 
 
A nice thing here is that it should be possible to overlay a dynamic cell-cell contact map on pretty well any agent-based model as an extra data structure (even as a post-processing step), so the insights and methods could be rolled out quite a bit further.

Mental note to self: when making standardized data analysis tools, add this! :-) 

edit
I've always had this in the back of my mind in my models.  All cell agents already record a unique ID and parent cell ID, so lineage tracking should be possible in post-processing.  

+Hector Gomez might be interested in any sort of network / topology analysis that mgith be possible with such post-processing of ABMs, since I believe he's interested in this for simulated and real vascular networks. 
/edit
Interesting review about how game theory (including game theory on networks) can be used to study the interactions between cells in a homeostatic tissue (made of cooperators) and how defectors (cancer cells) can disrupt that ...
2
Jacob Scott's profile photo
 
did this comment make it onto the blog?
Add a comment...

Paul Macklin

Shared publicly  - 
 
Aren't I a fast train? (Don't mind my slow little brother ...)
2
David Basanta's profile photo
 
I think both are pretty fast... 
Add a comment...

Paul Macklin

Shared publicly  - 
 
Application deadline for 3 paid undergrad cancer modeling positions extended: Due 11:59 pm May 15, interviews May 13-17. 

Looking for an interdisciplinary team of a computer scientist/developer, modeler, and biologist/pre-med to work together to make cancer simulators more powerful and easier to use. 

Details here: http://mathcancer.org/Opportunities.php#URAP_2013
1
Add a comment...
In his circles
180 people
Have him in circles
174 people
Joshua Sunday's profile photo
Ashok Yakkaldevi's profile photo
luis alfredo aaron leonis's profile photo
Katie Joseph's profile photo
Jasper Lin's profile photo
Russ Rockne's profile photo
Edward Flach's profile photo
Ararso Kedir's profile photo
Maciek Swat's profile photo

Paul Macklin

Shared publicly  - 
1
Add a comment...

Paul Macklin

Shared publicly  - 
1
Roeland Merks's profile photo
 
Yup!
Add a comment...

Paul Macklin

Shared publicly  - 
 
Ah, now I have an article for journal club next week. :-)  
2
Add a comment...

Paul Macklin

Shared publicly  - 
 
+Jill Gallaher , is the long-awated agent paper at last?! :-)

Happy to see it out. Looks like I may have another standard ABM reference to cite in my future literature review sections. :-)
A new paper from +Jill Gallaher and +Alexander Anderson is out on the arXiv.  I asked Jill for a PLoS style 'author summary' in non-technical language, and here it is: Author Summary: A tumor can be thought of as an ecosy...
4
Jill Gallaher's profile photo
 
Yes, I was even making a few corrections this morning. Argh. But, yes, it's done.
Add a comment...

Paul Macklin

Shared publicly  - 
 
It's definitely worth remembering that mice, bioegineered tissues, simulators, and such are all "model systems".  When we speak with big data people, we learn of data models.  "Model" is definitely a broader term than we sometimes remember! :-)
2
David Basanta's profile photoPaul Macklin's profile photo
2 comments
 
+David Basanta Yep! We all study systems that approximate in vivo cancer. And those who work with in vivo cancer often spend their time trying to simplify into statistical models. ;-)
Add a comment...

Paul Macklin

Shared publicly  - 
 
Paul Macklin (@MathCancer) tweeted at 8:20 AM on Fri, May 17, 2013:
Congrats to 2013 @USC grads. Very proud of Alice Hyun and Margy Gunnar (Macklin #cancer lab members)
(https://twitter.com/MathCancer/status/335414405862920192)

Get the official Twitter app at https://twitter.com/download
Instantly connect to what's most important to you. Follow your friends, experts, favorite celebrities, and breaking news.
1
Add a comment...
People
In his circles
180 people
Have him in circles
174 people
Joshua Sunday's profile photo
Ashok Yakkaldevi's profile photo
luis alfredo aaron leonis's profile photo
Katie Joseph's profile photo
Jasper Lin's profile photo
Russ Rockne's profile photo
Edward Flach's profile photo
Ararso Kedir's profile photo
Maciek Swat's profile photo
Work
Occupation
Biomathematician
Employment
  • University of Southern California
    Assistant Professor of Research Medicine, 2011 - present
  • University of Dundee
    Lecturer (permanent staff), 2010 - 2011
  • University of Texas Health Science Center, Houston
    Assistant Professor, 2007 - 2010
Places
Map of the places this user has livedMap of the places this user has livedMap of the places this user has lived
Currently
Pasadena, CA USA
Previously
Fremont, NE USA - Lincoln, NE USA - Minneapolis, MN USA - Irvine, CA USA - Houston, TX USA - Berlin, Germany - Hannover, Germany - Dundee, United Kingdom
Story
Tagline
Biomathematician - patient-specific cancer modeling
Education
  • University of California, Irvine
    Ph.D. Mathematics, 2003 - 2007
  • University of Minnesota, Twin Cities
    M.S. Mathematics, 2000 - 2003
  • University of Nebraska–Lincoln
    B.A. Mathematics and German, 1995 - 1999
Basic Information
Gender
Male
Relationship
Married